phenol red free opti mem tm i reduced serum medium (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
99
Structured Review
Thermo Fisher
phenol red free opti mem tm i reduced serum medium
Phenol Red Free Opti Mem Tm I Reduced Serum Medium, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/opti+mem+reduced+serum+medium/Phenol+Red/bio_rxiv__64898__2026__04__10__717554-212-58-66
Average 99 stars, based on 1 article reviews
Phenol Red Free Opti Mem Tm I Reduced Serum Medium, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/opti+mem+reduced+serum+medium/Phenol+Red/bio_rxiv__64898__2026__04__10__717554-212-58-66
Average 99 stars, based on 1 article reviews
phenol red free opti mem tm i reduced serum medium - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Transfection:Article Title: Molecular features, antiviral activity, and immunological expression assessment of interferon-related developmental regulator 1 (IFRD1) in red-spotted grouper (Epinephelus akaara). Article Snippet: Interferon-related developmental regulator 1 (IFRD1) is a viral responsive gene associated with interferongamma.. Herein, we identified the IFRD1 gene (EaIFRD1) from red-spotted grouper (Epinephelus akaara), evaluated its transcriptional responses, and investigated its functional features using various biological assays.. EaIFRD1 encodes a protein comprising 428 amino acids with a molecular mass of 48.22 kDa. Article Title: Estrogen treatment in combination with pyruvate kinase M2 inhibition precipitate significant cumulative antitumor effects in colorectal cancer. Article Snippet: .. Lipofectamine RNAiMAX Transfection Reagent and Article Title: Adipose tissue protein kinase D (PKD): regulation of signalling networks and its sex-dependent effects on metabolism Article Snippet: .. Prior to transfection, RNAiMAX (Invitrogen, USA) was diluted in Article Title: High-throughput Oligopaints identifies druggable 3D genome regulators Article Snippet: .. RNAiMAX transfection reagent (Thermo Fisher Scientific) was diluted in Article Title: β-TrCP-Mediated Proteolysis of Mis18β Prevents Mislocalization of CENP-A and Chromosomal Instability. Article Snippet: The Mis18b (OIP5) siRNA was purchased from Sigma Aldrich (SASI_Hs01_00199026) whereas the custom b-TrCP1 (AAGUGGAAUUUGUGGAACAUCUU) and nontargeting control pool (D-001810-10-20) siRNAs were ordered from Horizon Discovery. .. Following 48 h of seeding, the cells were forward transfected with 15 nM final concentration of siRNAs using RNAiMAX (13778150, Invitrogen) and Article Title: Androgen receptor modulatory miR-1271-5p can promote hormone sensitive prostate cancer cell growth Article Snippet: MiRCURY LNA (Locked Nucleic Acid) miR inhibitor (ASOs) and mimic (Exiqon) for miR-1271–5p were transfected into cells at 60–80% confluency, in antibiotic-free RPMI, using LipofectamineTM RNAiMAX Reagent (Invitrogen, MA, USA), according to the manufacturer’s instructions, in 6-well plates. .. Transfection mixes were prepared in Incubation:Article Title: Role of miR-125b-5p in modulating placental SIRT7 expression and its implications for lipid metabolism in gestational diabetes. Article Snippet: Gestational diabetes is marked impaired glucose tolerance, poses various adverse outcomes including increased BMI and obesity.. These outcomes results from excess lipid accumulation which is marked by elevated triglycerides.. In GDM, placenta exhibits altered lipid metabolism, including reduced fatty acid oxidation and increased triglyceride accumulation. Concentration Assay:Article Title: β-TrCP-Mediated Proteolysis of Mis18β Prevents Mislocalization of CENP-A and Chromosomal Instability. Article Snippet: The Mis18b (OIP5) siRNA was purchased from Sigma Aldrich (SASI_Hs01_00199026) whereas the custom b-TrCP1 (AAGUGGAAUUUGUGGAACAUCUU) and nontargeting control pool (D-001810-10-20) siRNAs were ordered from Horizon Discovery. .. Following 48 h of seeding, the cells were forward transfected with 15 nM final concentration of siRNAs using RNAiMAX (13778150, Invitrogen) and Cell Culture:Article Title: Melatonin Alleviates Oxidative Stress-Induced Mitochondrial Dysfunction Through Ameliorating NAD + Homeostasis of hDPSCs for Cell-Based Therapy. Article Snippet: Human dental pulp stem cells (hDPSCs) exhibit amazing therapeutic abilities in a variety of diseases due to their remarkable self‐ renewal capacity and multi‐differentiation potential.. However, their therapeutic potential could be weakened by various factors such as oxidative stress in cell survival microenvironment In Vivo.. Here, we explored the protective effect and mechanism of melatonin (Mel) on hDPSCs transplanted in a type 1 diabetes mellitus (T1DM) rat model. Nicotinamide adenine dinucleotide (NAD) metabolism and mitochondrial function were remarkably impaired in T1DM rats caused by oxidative stress, while the combination of Mel and post‐ hDPSCs transplantation could rebalance NAD homeostasis through regulating NAMPT‐NAD‐SIRT1 axis. |